1. Signaling Pathways
  2. Anti-infection
  3. HBV

HBV

Hepatitis B virus

HBV (Hepatitis B virus), abbreviated HBV, is a species of the genus Orthohepadnavirus, which is likewise a part of the Hepadnaviridae family of viruses. HBV causes the disease hepatitis B. The hepatitis B virus is classified as the type species of the Orthohepadnavirus, which contains three other species: the Ground squirrel hepatitis virus, Woodchuck hepatitis virus, and theWoolly monkey hepatitis B virus. The genus is classified as part of the Hepadnaviridae family. HBV is divided into four major serotypes (adr, adw, ayr, ayw) based on antigenic epitopes present on its envelope proteins, and into eight genotypes (A–H) according to overall nucleotide sequence variation of the genome. The genotypes have a distinct geographical distribution and are used in tracing the evolution and transmission of the virus. Differences between genotypes affect the disease severity, course and likelihood of complications, and response to treatment and possibly vaccination.

Cat. No. Product Name Effect Purity Chemical Structure
  • HY-147217
    Bepirovirsen
    Inhibitor 98.44%
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
    Bepirovirsen
  • HY-19314
    Azvudine
    Inhibitor 99.60%
    Azvudine (RO-0622) is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, HBV and HCV. Azvudine exerts highly potent inhibition on HIV-1 (EC50s ranging from 0.03 to 6.92 nM) and HIV-2 (EC50s ranging from 0.018 to 0.025 nM). Azvudine inhibits NRTI-resistant viral strains. Azvudine is a click chemistry reagent, itcontains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.
    Azvudine
  • HY-17426
    Famciclovir
    Inhibitor 99.97%
    Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection.
    Famciclovir
  • HY-B0017
    Telbivudine
    Inhibitor 99.98%
    Telbivudine (Epavudine), an orally active thymidine nucleoside analog, is a potent antiviral inhibitor of hepatitis B virus (HBV) replication.
    Telbivudine
  • HY-124600
    NVR 3-778
    Inhibitor 99.47%
    NVR 3-778 is a first-in-Class and oral bioavailable HBV CAM (capsid assembly modulator) belonging to the SBA (sulfamoylbenzamide) class, with anti-HBV activity.
    NVR 3-778
  • HY-13859
    Clevudine
    Inhibitor 99.93%
    Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice.
    Clevudine
  • HY-109197
    Vonafexor
    Inhibitor 99.32%
    Vonafexor (EYP001) is an orally active, non-steroidal and selective FXR agonist. Vonafexor shows significant HBsAg reduction when combined with Peg-IFNα. Vonafexor can be used for anti-HBV research.
    Vonafexor
  • HY-W018791
    Bifendate
    Inhibitor 99.91%
    Bifendate (DDB) is a synthetic intermediate of Schisandrin C with anti-HBV efficacy in research of chronic hepatitis B.
    Bifendate
  • HY-16468
    Squalamine
    Inhibitor ≥98.0%
    Squalamine(MSI-1256) is an aminosterol compound with potent broad spectrum antiviral activity.
    Squalamine
  • HY-147255
    Canocapavir
    Inhibitor 98.40%
    Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .
    Canocapavir
  • HY-100029
    Bay 41-4109
    Inhibitor 98.98%
    BAY 41-4109 is a potent inhibitor of human hepatitis B virus (HBV) with an IC50 of 53 nM.
    Bay 41-4109
  • HY-100028
    AT-130
    Inhibitor 98.31%
    AT-130, a phenylpropenamide derivative, is a potent hepatitis B virus (HBV) replication non-nucleoside inhibitor. AT-130 inhibits the viral DNA synthesis with an EC50 of 0.13 μM. AT-130 inhibits both wt and mutant HBVs. AT-130 has anti-HBV activity in hepatoma cells.
    AT-130
  • HY-19447
    Besifovir
    Inhibitor ≥98.0%
    Besifovir (LB80331), a parent agent converted by LB80380 (HY-19447A), further metabolizes to its active form, LB80317 (HY-106235). Besifovir is an orally active, novel antiviral agent against hepatitis B virus (HBV).
    Besifovir
  • HY-N1365
    Isoscopoletin
    Inhibitor 99.94%
    Isoscopoletin (6-Hydroxy-7-methoxycoumarin) is an active constituent in Artemisia argyi leaves. Isoscopoletin shows substantial inhibition against cell proliferation, with IC50s of 4.0 μM and 1.6 μM for human CCRF-CEM leukaemia cells and multidrug resistant subline CEM/ADR5000, respectively. Isoscopoletin (6-Hydroxy-7-methoxycoumarin) possesses inhibitory activity against HBV replication.
    Isoscopoletin
  • HY-116999
    IR415
    Inhibitor 99.66%
    IR415 is a potent anti-HBV agent and inhibits HBV replication by blocking the HBx activity. IR415 selectively interacts with HBx (Kd=2 nM) and blocks HBV-mediated RNAi suppression, reverses the inhibitory effect of HBx protein on the activity of the dicer endoribonuclease. HBx: hepatitis B virus X protein.
    IR415
  • HY-131596B
    Emtricitabine triphosphate tetrasodium salt
    Inhibitor 99.06%
    Emtricitabine triphosphate tetrasodium salt is the tetrasodium salt form of Emtricitabine triphosphate (HY-131596). However,Emtricitabine triphosphate ((-)-Emtricitabine triphosphate) is the phosphorylated anabolite of Emtricitabine (HY-17427),a nucleoside reverse transcriptase inhibitor,targeting to HIV and HBV.
    Emtricitabine triphosphate tetrasodium salt
  • HY-112564
    JNJ-632
    Inhibitor 99.61%
    JNJ-632 is a hepatitis B virus (HBV) capsid assembly modulator (CAM).
    JNJ-632
  • HY-124614
    GLP-26
    Inhibitor 98.23%
    GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC50=3 nM), and reduces cccDNA by >90% at 1 μM. GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools. GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    GLP-26
  • HY-126970
    HBF-0259
    Inhibitor 99.99%
    HBF-0259 is a potent and selective inhibitor of hepatitis B virus (HBV) surface antigen (HBsAg) secretion, with an EC50 of 1.5 μM in HepG2.2.15 cells. HBF-0259 has no effect on HBV DNA synthesis.
    HBF-0259
  • HY-116364B
    AZT triphosphate tetraammonium
    Inhibitor 99.45%
    AZT triphosphate (3'-Azido-3'-deoxythymidine-5'-triphosphate) tetraammonium is an active triphosphate metabolite of Zidovudine (AZT). AZT triphosphate tetraammonium exhibits antiretroviral activity and inhibits replication of HIV. AZT triphosphate tetraammonium also inhibits the DNA polymerase of HBV. AZT triphosphate tetraammonium activates the mitochondria-mediated apoptosis pathway.
    AZT triphosphate tetraammonium
Cat. No. Product Name / Synonyms Application Reactivity